Trial Review

The ANZCTR website will be unavailable from 1pm until 3pm (AEDT) on Wednesday the 30th of October for website maintenance. Please be sure to log out of the system in order to avoid any loss of data.

The safety and scientific validity of this study is the responsibility of the study sponsor and investigators. Listing a study does not mean it has been endorsed by the ANZCTR. Before participating in a study, talk to your health care provider and refer to this information for consumers
Trial registered on ANZCTR


Registration number
ACTRN12616001032448
Ethics application status
Approved
Date submitted
29/07/2016
Date registered
4/08/2016
Date last updated
8/03/2021
Date data sharing statement initially provided
8/03/2021
Date results provided
8/03/2021
Type of registration
Prospectively registered

Titles & IDs
Public title
Are viruses associated with disc degeneration or disc herniation? An evidence of concept study.
Scientific title
Are viruses associated with disc degeneration or disc herniation? An evidence of concept study.
Secondary ID [1] 289782 0
Nil
Universal Trial Number (UTN)
Trial acronym
VIRAdisc
Linked study record

Health condition
Health condition(s) or problem(s) studied:
Intervertebral disc degeneration 299674 0
Intervertebral disc herniation 299675 0
Viral infection 299676 0
back pain 299677 0
Condition category
Condition code
Infection 299614 299614 0 0
Other infectious diseases
Musculoskeletal 299672 299672 0 0
Other muscular and skeletal disorders

Intervention/exposure
Study type
Observational
Patient registry
False
Target follow-up duration
Target follow-up type
Description of intervention(s) / exposure
Fifteen participants will be recruited prior to undergoing disc herniation surgery in the lumbar spine. Inclusion criteria are: a history of low back pain preceding disc herniation, aged over 18 years, undergoing surgery for removal of disc material. Exclusion criteria are: immuno-compromised, currently ill with an infection.

With informed consent we will use sections of vertebral disc fragments removed during surgical interventions from fifteen patients being treated for disc degeneration or herniation. The sterile samples will be immediately stored at 4degreesC for no more than 48 hours, before transport to Murdoch University for storage at minus80degreesC. Following this, samples will be prepared for next generation sequencing for detection of pathogens.

For initial total nucleic acid extractions, samples of intervertebral disc material will be homogenised using a mechanical tissue disruption system, followed by extraction of total nucleic acids using a MagMax-96 Viral Isolation Kit (Ambion), according to the manufacturer’s instructions. In order to capture potential RNA and DNA viral species for downstream NGS, total nucleic acid will be converted to dsDNA via a combination of random priming and Klenow fragment based extension and PCR (Ng, Kondov, Deng, Van Eenennaam, & Neilbergs, 2015). Briefly, samples will be subject to reverse transcription using 1 micro L primer NGS1random (CCTTGAAGGCGGACTGTGAGN8) at a concentration of 100 micro M, 7 micro L of purified sample, 10 micro L of Protoscript II buffer (New England BioLabs) and 2 micro L of Protoscript II First Strand cDNA enzyme (New England BioLabs) under the following reaction conditions: 25 degreesC for 5 min, 42degreesC for 60 min and 95degreesC for 3 min. Complementary strand synthesis will be performed by adding 2 micro L of primer NGS1random (10 micro M concentration) and 1 micro L of Klenow polymerase (Promega) and incubating the reaction at 37degreesC for 1 hour. Double-stranded DNA products will then be amplified using primer NGS1 (CCTTGAAGGCGGACTGTGAG) at a final concentration of 1 micro M and AmpliTaq Gold 360 mastermix (Life Technologies) under the following conditions: denaturation at 95degreesC for 5 min, followed by 40 cycles of 95degreesC for 1 min, 55degreesC for 1 min, 72degreesC for 1min (increasing by 5 sec per cycle), and a final extension step of 72degreesC for 10 min. PCR product clean up will be performed using a Wizard SV gel and PCR kit (Promega). Following PCR clean up, each sample will undergo library preparation and individual barcoding using a Nextera XT DNA library preparation kit (Illumina) according to the manufacturer’s instructions. Final libraries will pooled in equimolar amounts, and sequencing performed on an Illumina MiSeq using a V3 2x300 flowcell.
Read data will be imported into CLC Genomics Workbench (Qiagen) and demultiplexed. Total reads from each sample will be mapped to the reference human genome to remove host reads, and unmapped reads will be collected for further analysis. Unmapped reads will undergo de novo assembly, and contigs will be searched for homology to viral, bacterial and fungal agents using BLASTn and BLASTx algorithms through the NCBI server (http://blast.ncbi.nlm.nih.gov/Blast.cgi), Diamond (Buchfink, Xie, & Huson, 2015), and One Codex.

The participants will complete a brief questionnaire which asks about their age, sex, time since their first ever attack of low back pain.
Participants will receive the results of the PCRs at about 1 month after collection. No further follow up will occur by the team after this information is passed on to the surgeon, GP and participant.
Intervention code [1] 295446 0
Early Detection / Screening
Comparator / control treatment
Nil
Control group
Uncontrolled

Outcomes
Primary outcome [1] 299084 0
. Pathogens present on PCR testing of disc material after surgery. Disc samples will be obtained at surgery for routine discectomy
Timepoint [1] 299084 0
collected at surgery, and assessed within 1 month,
Secondary outcome [1] 326103 0
Virus presence found via PCR assay. Disc samples will be obtained at surgery for routine discectomy.
Timepoint [1] 326103 0
collected at surgery, and assessed within 1 month,

Eligibility
Key inclusion criteria
Inclusion criteria are: a history of low back pain preceding disc herniation, aged over 18 years, undergoing surgery for removal of disc material.
Minimum age
18 Years
Maximum age
No limit
Sex
Both males and females
Can healthy volunteers participate?
No
Key exclusion criteria
Exclusion criteria are: immune suppressed participants or currently ill with an infection. Also previous spinal surgery.

Study design
Purpose
Duration
Selection
Timing
Statistical methods / analysis
No sample size estimates were performed. Observational descriptive statistics of the presence or absence of pathogens in the disc material. The sample size is based on an evidence of concept study and not proof of concept. It is a convenience sample based on the size similar studies. A fully powered study will ensue subject to funding and evidence of concept.

Recruitment
Recruitment status
Completed
Date of first participant enrolment
Anticipated
21/07/2017
Actual
3/08/2017
Date of last participant enrolment
Anticipated
21/12/2017
Actual
26/02/2018
Date of last data collection
Anticipated
Actual
31/05/2018
Sample size
Target
15
Accrual to date
Final
15
Recruitment in Australia
Recruitment state(s)
WA
Recruitment hospital [1] 6302 0
St John of God Hospital, Subiaco - Subiaco
Recruitment postcode(s) [1] 13836 0
6008 - Subiaco

Funding & Sponsors
Funding source category [1] 294162 0
University
Name [1] 294162 0
Murdoch University, School of Health Professions
Country [1] 294162 0
Australia
Primary sponsor type
University
Name
Murdoch University
Address
90 South Street
Murdoch 6150 WA
Country
Australia
Secondary sponsor category [1] 292995 0
None
Name [1] 292995 0
None
Address [1] 292995 0
Country [1] 292995 0

Ethics approval
Ethics application status
Approved
Ethics committee name [1] 295572 0
Murdoch University HREC
Ethics committee address [1] 295572 0
Ethics committee country [1] 295572 0
Australia
Date submitted for ethics approval [1] 295572 0
04/08/2016
Approval date [1] 295572 0
16/09/2016
Ethics approval number [1] 295572 0
2016/156
Ethics committee name [2] 295573 0
St John of God Subiaco HREC
Ethics committee address [2] 295573 0
Ethics committee country [2] 295573 0
Australia
Date submitted for ethics approval [2] 295573 0
08/09/2016
Approval date [2] 295573 0
13/12/2016
Ethics approval number [2] 295573 0
1074

Summary
Brief summary
Trial website
Trial related presentations / publications
Public notes

Contacts
Principal investigator
Name 67802 0
Prof Bruce Walker
Address 67802 0
Room 1.011, Building 461, Murdoch University, 90 South St. Murdoch 6150 WA
Country 67802 0
Australia
Phone 67802 0
+61 8 93601297
Fax 67802 0
Email 67802 0
[email protected]
Contact person for public queries
Name 67803 0
Bruce Walker
Address 67803 0
Room 1.011, Building 461, Murdoch University, 90 South St. Murdoch 6150 WA
Country 67803 0
Australia
Phone 67803 0
+61 8 93601297
Fax 67803 0
Email 67803 0
[email protected]
Contact person for scientific queries
Name 67804 0
Bruce Walker
Address 67804 0
Room 1.011, Building 461, Murdoch University, 90 South St. Murdoch 6150 WA
Country 67804 0
Australia
Phone 67804 0
+61 8 93601297
Fax 67804 0
Email 67804 0
[email protected]

Data sharing statement
Will individual participant data (IPD) for this trial be available (including data dictionaries)?
No
No/undecided IPD sharing reason/comment
There are 15 cases. The results have been published and a summary provided in this ANZCTR entry


What supporting documents are/will be available?

No Supporting Document Provided



Results publications and other study-related documents

Documents added manually
No documents have been uploaded by study researchers.

Documents added automatically
No additional documents have been identified.